V5V
(Plasmid #29423)

• Depositing Lab: Steven Vogel
• Publication: Thaler et al Proc Natl Acad Sci U S A. 2009 Apr 14. 106(15):6369-74.

Backbone

• Vector backbone: pEGFP C1
• Backbone size w/o insert (bp): 3984
• Vector type: Mammalian Expression ; Anisotropy and brightness standard
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus-5-Venus
• Alt name: V5V
• Insert Size (bp): 1435

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (not destroyed)
• 3′ cloning site: Bam HI (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Anisotropy standard and brightness standard

Linker sequence: TCCGGACTCAGATCT

Please note that digest with the enzymes used for cloning will not remove the full V5V insert from the plasmid.