-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 29323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUB6/V5-His A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5422
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZeppo1
-
Alt nameZpo1
-
Alt nameZnf703
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1790
-
Tags
/ Fusion Proteins
- V5 (C terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TCAGTGTTAGACTAGTAAATTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUb6-Zpo1-V5/His was a gift from Zena Werb (Addgene plasmid # 29323 ; http://n2t.net/addgene:29323 ; RRID:Addgene_29323) -
For your References section:
Zeppo1 is a novel metastasis promoter that represses E-cadherin expression and regulates p120-catenin isoform expression and localization. Slorach EM, Chou J, Werb Z. Genes Dev. 2011 Feb 11. ():. 10.1101/gad.1998111 PubMed 21317240