pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
(Plasmid #28289)

• Purpose: (Empty Backbone) 3rd generation lentiviral plasmid; This plasmid is the backbone for the DECIPHER libraries (currently DISCONTINUED)
• Depositing Labs: Alex Chenchik, Gus Frangou
• Publication: DECIPHER library reagents (unpublished)

Backbone

• Vector backbone: pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
• Backbone manufacturer: Cellecta
• Backbone size (bp): 7500
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): SURE
• Growth instructions: Plasmids need to be grown in OmniMAX 2 T1R (Life Technologies) or SURE (Agilent) Recombination defective E.coli cells. SURE cells are kanamycin and tetracycline resistant. When transforming the SURE strain with plasmids carrying chloramphenicol resistance gene, select for transformants on LB agar plates containing 100 µg/ml chloramphenicol. The SURE strain is resistant (Camr) to concentrations of <40 µg/ml chloramphenicol, but sensitive (Cams) to 100 µg/ml chloramphenicol.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: None
• Alt name: DECIPHER shRNA Expression Vector

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (BpiI) (not destroyed)
• 3′ cloning site: BbsI (BpiI) (not destroyed)
• 5′ sequencing primer: FwdU6 (CAAGGCTGTTAGAGAGATAATTGGAA)

Resource Information

• Supplemental Documents:
  • DECIPHER Manual for shRNA cloning
• References:
  • DECIPHER Project Website
  • DECIPHER Data and Pathway Analysis Software
  • DECIPHER Resources (includes link to User Manual)
• Articles Citing this Plasmid:
  • 10 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry