pDTnLAPP2A frame 0
(Plasmid #28226)

• Depositing Lab: Harald von Melchner
• Publication: Schnutgen et al Nat Methods. 2011 Feb . 8(2):103-4.

Backbone

• Vector backbone: CA1
• Backbone size w/o insert (bp): 1672
• Vector type: Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hygrophosphotransferase-P2A-Enhanced Green Fluorescent Protein
• Alt name: Hygro
• Alt name: EGFP
• Alt name: nLAP
• Species: Aequorea victoria, E. coli
• Insert Size (bp): 3060
• Tags / Fusion Proteins:
  • EGFP (C terminal on insert)
  • nLAP-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ATGCAACTGCAAGAGGGTTT
• 3′ sequencing primer: TGCACCCAACTGATCTTCAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Francis A. Stewart, Dresden, Germany
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Poser et al., Nature Meth. 5, (2008), 409-415