Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TDP43 NOTAG11
(Plasmid #28210)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 28210 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG-EGFP/RFP-int
  • Backbone size w/o insert (bp) 5310
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5a in LB media at 37C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tar DNA binding protein
  • Alt name
    TDP43
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    246
  • Mutation
    aa193-274 only
  • GenBank ID
    NM_007375
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site Mlu1 (not destroyed)
  • 5′ sequencing primer TTCCTACAGCTCCTGGGCAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TDP43 NOTAG11 was a gift from Zuoshang Xu (Addgene plasmid # 28210 ; http://n2t.net/addgene:28210 ; RRID:Addgene_28210)
  • For your References section:

    The C-terminal TDP-43 fragments have a high aggregation propensity and harm neurons by a dominant-negative mechanism. Yang C, Tan W, Whittle C, Qiu L, Cao L, Akbarian S, Xu Z. PLoS One. 2010 . 5(12):e15878. 10.1371/journal.pone.0015878 PubMed 21209826