wtTDP43tdTOMATOHA
(Plasmid #28205)

• Depositing Lab: Zuoshang Xu
• Publication: Yang et al PLoS One. 2010 . 5(12):e15878.

Backbone

• Vector backbone: pCAG-EGFP/RFP-int
• Backbone size w/o insert (bp): 5310
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5a in LB media at 37C
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tar DNA binding protein
• Alt name: TDP43
• Species: H. sapiens (human)
• Insert Size (bp): 2800
• GenBank ID: NM_007375
• Entrez Gene: TARDBP (a.k.a. ALS10, TDP-43)
• Tags / Fusion Proteins:
  • tdtomato (C terminal on insert)
  • HA tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (destroyed during cloning)
• 3′ cloning site: Mlu1 (not destroyed)
• 5′ sequencing primer: TTCCTACAGCTCCTGGGCAA

Resource Information

• Articles Citing this Plasmid:
  • 13 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry