Stagia3
(Plasmid
#28177)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneSV40 basal promoter-GFP-IRES-AP
-
Backbone manufacturerDouglas Kim
- Backbone size w/o insert (bp) 6355
-
Vector typeMammalian Expression ; Chicken expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStop TATA
-
Alt namesynthetic polyadenylation terminator
-
Alt nameTATA box
-
Insert Size (bp)256
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not (not destroyed)
- 3′ cloning site Age1 (not destroyed)
- 5′ sequencing primer GTTCCGCGCACATTTCCCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Stagia3 was a gift from Connie Cepko (Addgene plasmid # 28177 ; http://n2t.net/addgene:28177 ; RRID:Addgene_28177) -
For your References section:
Analysis of thyroid response element activity during retinal development. Billings NA, Emerson MM, Cepko CL. PLoS One. 2010 . 5(10):e13739. 10.1371/journal.pone.0013739 PubMed 21060789