Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CYP11A1 (3N9Y)
(Plasmid #28119)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 28119 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCW-LIC (Addgene plasmid 26098)
  • Backbone manufacturer
    SGC
  • Backbone size w/o insert (bp) 6980
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CYP11A1:HPC09N-C05:C214491
  • Alt name
    cytochrome P450, family 11, subfamily A, polypeptide 1
  • Alt name
    PDB: 3N9Y
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1824
  • Entrez Gene
    CYP11A1 (a.k.a. CYP11A, CYPXIA1, P450SCC)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Ligation-independent cloning (unknown if destroyed)
  • 3′ cloning site Ligation-independent cloning (unknown if destroyed)
  • 5′ sequencing primer pCW-SEQ-fwd (ACATCGTATAACGTTACTGG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PDB: 3N9Y. http://www.thesgc.org/structures/3N9Y/

Human CYP11A1 fused with a portion of its cognate redox partner, ferredoxin. The CYP11A1 insert in this plasmid does not contain amino acids a1-40 of GenBank reference sequence NP_000772.2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CYP11A1 (3N9Y) was a gift from Cheryl Arrowsmith (Addgene plasmid # 28119 ; http://n2t.net/addgene:28119 ; RRID:Addgene_28119)