CYP11A1 (3N9Y)
(Plasmid #28119)

• Purpose: Bacterial expression for structure determination; may not be full ORF
• Depositing Lab: Cheryl Arrowsmith
• Publication: SGC Q2 (unpublished)

Backbone

• Vector backbone: pCW-LIC (Addgene plasmid 26098)
• Backbone manufacturer: SGC
• Backbone size w/o insert (bp): 6980
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CYP11A1:HPC09N-C05:C214491
• Alt name: cytochrome P450, family 11, subfamily A, polypeptide 1
• Alt name: PDB: 3N9Y
• Species: H. sapiens (human)
• Insert Size (bp): 1824
• Entrez Gene: CYP11A1 (a.k.a. CYP11A, CYPXIA1, P450SCC)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Ligation-independent cloning (unknown if destroyed)
• 3′ cloning site: Ligation-independent cloning (unknown if destroyed)
• 5′ sequencing primer: pCW-SEQ-fwd (ACATCGTATAACGTTACTGG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

PDB: 3N9Y. http://www.thesgc.org/structures/3N9Y/

Human CYP11A1 fused with a portion of its cognate redox partner, ferredoxin. The CYP11A1 insert in this plasmid does not contain amino acids a1-40 of GenBank reference sequence NP_000772.2.