CYP11A1 (3N9Z/3NA0)
(Plasmid
#28118)
-
PurposeBacterial expression for structure determination; may not be full ORF
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28118 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCW-LIC (Addgene plasmid 26098)
-
Backbone manufacturerSGC
- Backbone size w/o insert (bp) 6980
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCYP11A1:HPC071-D08:C40435
-
Alt namecytochrome P450, family 11, subfamily A, polypeptide 1
-
Alt namePDB: 3N9Z
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1476
-
Entrez GeneCYP11A1 (a.k.a. CYP11A, CYPXIA1, P450SCC)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Ligation-independent cloning (unknown if destroyed)
- 3′ cloning site Ligation-independent cloning (unknown if destroyed)
- 5′ sequencing primer pCW-SEQ-fwd (ACATCGTATAACGTTACTGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PDB: 3N9Z. http://www.thesgc.org/structures/3N9Z/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CYP11A1 (3N9Z/3NA0) was a gift from Cheryl Arrowsmith (Addgene plasmid # 28118 ; http://n2t.net/addgene:28118 ; RRID:Addgene_28118)