-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-Myc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLrh-1
-
Alt nameliver receptor homolog-1
-
SpeciesM. musculus (mouse)
-
Entrez GeneNr5a2 (a.k.a. AU020803, D1Ertd308e, Ftf, LRH-1, UF2-H3B)
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer pCMV - GATCCGGTACTAGAGGAACTGAAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-myc-LRH1(ES) was a gift from Austin Cooney (Addgene plasmid # 28093 ; http://n2t.net/addgene:28093 ; RRID:Addgene_28093) -
For your References section:
Canonical Wnt/I. Wagner RT, Xu X, Yi F, Merrill BJ, Cooney AJ. Stem Cells. 2010 Oct . 28(10):1794-804. 10.1002/stem.502 PubMed 20734354