-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonephrGFP-N1
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKeap1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1847
-
Entrez GeneKEAP1 (a.k.a. INrf2, KLHL19)
-
Tag
/ Fusion Protein
- hrGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CAGCTGACCAGCCTGGGCAAG
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hrGFP-Keap1 was a gift from Qing Zhong (Addgene plasmid # 28025 ; http://n2t.net/addgene:28025 ; RRID:Addgene_28025) -
For your References section:
Keap1 facilitates p62-mediated ubiquitin aggregate clearance via autophagy. Fan W, Tang Z, Chen D, Moughon D, Ding X, Chen S, Zhu M, Zhong Q. Autophagy. 2010 Jul 22. 6(5):. 10.4161/auto.6.5.12189 PubMed 20495340