-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9204
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeo marker is outside the LTRs and will not be packaged into virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALE1
-
Alt nameDesigner TAL Effector 1
-
Alt namedTALE1
-
SpeciesSynthetic
-
Insert Size (bp)3531
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTTTGAGTTTGGATCTTGGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-EF1a-TALE1 was a gift from Feng Zhang (Addgene plasmid # 27969 ; http://n2t.net/addgene:27969 ; RRID:Addgene_27969) -
For your References section:
Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Nat Biotechnol. 2011 Feb;29(2):149-53. doi: 10.1038/nbt.1775 10.1038/nbt.1775 PubMed 21248753