VVVVVV
(Plasmid #27813)

• Depositing Lab: Steven Vogel
• Publication: Thaler et al Proc Natl Acad Sci U S A. 2009 Apr 14. 106(15):6369-74.

Backbone

• Vector backbone: pEGFP C1
• Backbone size w/o insert (bp): 3984
• Vector type: Mammalian Expression ; Anisotropy and brightness standard
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus-5-Venus-5-Venus-5-Venus-5-Venus-5-Venus
• Alt name: VVVVVV
• Insert Size (bp): 4296

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Resource Information

• Addgene Notes:
  • Addgene's diagnostic digest
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Anisotropy standard and brightness standard

The 1st Venus can be excised using a NheI-BSP E1 double digest; the 2nd Venus by BSP E1-BglII; the 3rd Venus by BglII-EcoRI; the 4th Venus by EcoRI-EcoRV; the 5th Venus by Eco RV-SalI and the last (6th) Venus by SalI-BamHI. The full insert can be released by a NheI-BamHI double-digest.

Due to the multiple Venus repeats in this plasmid, Addgene is unable to confirm the entire insert by sequencing. Please see Addgene's diagnostic digest for this plasmid by clicking the Notes from Addgene link above.