VVVVVV
(Plasmid
#27813)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27813 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP C1
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression ; Anisotropy and brightness standard
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus-5-Venus-5-Venus-5-Venus-5-Venus-5-Venus
-
Alt nameVVVVVV
-
Insert Size (bp)4296
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Anisotropy standard and brightness standard
The 1st Venus can be excised using a NheI-BSP E1 double digest; the 2nd Venus by BSP E1-BglII; the 3rd Venus by BglII-EcoRI; the 4th Venus by EcoRI-EcoRV; the 5th Venus by Eco RV-SalI and the last (6th) Venus by SalI-BamHI. The full insert can be released by a NheI-BamHI double-digest.
Due to the multiple Venus repeats in this plasmid, Addgene is unable to confirm the entire insert by sequencing. Please see Addgene's diagnostic digest for this plasmid by clicking the Notes from Addgene link above.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VVVVVV was a gift from Steven Vogel (Addgene plasmid # 27813 ; http://n2t.net/addgene:27813 ; RRID:Addgene_27813) -
For your References section:
Structural rearrangement of CaMKIIalpha catalytic domains encodes activation. Thaler C, Koushik SV, Puhl HL, Blank PS, Vogel SS. Proc Natl Acad Sci U S A. 2009 Apr 14. 106(15):6369-74. 10.1073/pnas.0901913106 PubMed 19339497