mVenus N1
(Plasmid #27793)

• Depositing Lab: Steven Vogel
• Publication: Koushik et al Biophys J. 2006 Dec 15. 91(12):L99-L101.
• Citations: 27 Articles

Backbone

• Vector backbone: pEYFP N1
• Backbone size w/o insert (bp): 3984
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mVenus N1
• Alt name: mVenus-N1
• Insert Size (bp): 720

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was created by mutagenesis of pEYFP-N1. When compared with EYFP, Venus contains the following mutations: F46L, F64L, M153T, V163A and S175G. This construct also contains A206K mutation to create a monomeric form of the fluorescent protein.

This plasmid contains a MCS upstream of mVenus so that a gene of interest can be cloned to create a fusion protein with a C-terminal mVenus tag.