Skip to main content
Addgene

VCA
(Plasmid #27792)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27792 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3940
  • Vector type
    Mammalian Expression ; Stoichiometry standard

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus-Cerulean-Amber
  • Alt name
    VCA
  • Insert Size (bp)
    2110

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Venus can be excised using a NheI-BSP E1 double digest; Cerulean by BglII-SalI and Amber by SalI-BamHI. The full insert can be released by a NheI-BamHI double-digest.

Due to the multiple fluorescent protein repeats in this plasmid, Addgene is unable to confirm the entire insert by sequencing. Please see Addgene's diagnostic digest for this plasmid by clicking the Notes from Addgene link above.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VCA was a gift from Steven Vogel (Addgene plasmid # 27792 ; http://n2t.net/addgene:27792 ; RRID:Addgene_27792)
  • For your References section:

    Anomalous surplus energy transfer observed with multiple FRET acceptors. Koushik SV, Blank PS, Vogel SS. PLoS One. 2009 . 4(11):e8031. 10.1371/journal.pone.0008031 PubMed 19946626
Commonly requested with: