Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO mouse ULK2 shRNA 93
(Plasmid #27635)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27635 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Growth instructions
    XL10 Gold Ultracompetent Cells from Stratagene. Grow in SOC media at 37oC
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mouse ULK2 shRNA 93
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    60

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

mouse ULK2 shRNA 93 TRC candidate.

shRNA oligo sequence - 5'-CCGGCGCCATCTGAACATGATGTTACTCGAGTAACATCATGTTCAGATGGCGTTTTT -3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO mouse ULK2 shRNA 93 was a gift from Reuben Shaw (Addgene plasmid # 27635 ; http://n2t.net/addgene:27635 ; RRID:Addgene_27635)
  • For your References section:

    Phosphorylation of ULK1 (hATG1) by AMP-Activated Protein Kinase Connects Energy Sensing to Mitophagy. Egan DF, Shackelford DB, Mihaylova MM, Gelino SR, Kohnz RA, Mair W, Vasquez DS, Joshi A, Gwinn DM, Taylor R, Asara JM, Fitzpatrick J, Dillin A, Viollet B, Kundu M, Hansen M, Shaw RJ. Science. 2010 Dec 23. ():. 10.1126/science.1196371 PubMed 21205641