pRS426 Gal TDP43
(Plasmid
#27466)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 27466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepRS426 Gal
- Backbone size w/o insert (bp) 7099
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTDP-43
-
Alt nameTDP43
-
SpeciesH. sapiens (human)
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pRSGal-Fwd GTTAATATACCTCTATACTTTAACGTCAAGGAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS426 Gal TDP43 was a gift from Aaron Gitler (Addgene plasmid # 27466 ; http://n2t.net/addgene:27466 ; RRID:Addgene_27466) -
For your References section:
A yeast TDP-43 proteinopathy model: Exploring the molecular determinants of TDP-43 aggregation and cellular toxicity. Johnson BS, McCaffery JM, Lindquist S, Gitler AD. Proc Natl Acad Sci U S A. 2008 Apr 29. 105(17):6439-44. 10.1073/pnas.0802082105 PubMed 18434538