Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRS416 Gal G294A YFP
(Plasmid #27448)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27448 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS416GAL
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TDP-43
  • Species
    H. sapiens (human)
  • Mutation
    Glycine 294 mutated to Alanine (G294A)
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)
  • Tag / Fusion Protein
    • YFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer pRSGal-Fwd GTTAATATACCTCTATACTTTAACGTCAAGGAGA
  • 3′ sequencing primer T3
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS416 Gal G294A YFP was a gift from Aaron Gitler (Addgene plasmid # 27448 ; http://n2t.net/addgene:27448 ; RRID:Addgene_27448)
  • For your References section:

    TDP-43 is intrinsically aggregation-prone, and amyotrophic lateral sclerosis-linked mutations accelerate aggregation and increase toxicity. Johnson BS, Snead D, Lee JJ, McCaffery JM, Shorter J, Gitler AD. J Biol Chem. 2009 Jul 24. 284(30):20329-39. 10.1074/jbc.M109.010264 PubMed 19465477