p307HU
(Plasmid #27386)

• Depositing Lab: David Bartel
• Publication: Shechner et al Science. 2009 Nov 27. 326(5957):1271-5.

Backbone

• Vector backbone: pUC19 modified
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: unligated form of ligase ribozyme
• Species: H. sapiens (human)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: T7

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A-
binding loop. DNA representing the unligated form of this ribozyme was
subcloned into pUC19 under a T7 transcription promoter,
followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an
EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was

GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC
CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT
GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT
GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC
AC

See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.