Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pH307HP
(Plasmid #27385)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27385 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19 modified
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    post- ligation product of ligase ribozyme
  • Species
    H. sapiens (human)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pH307HP is used to transcribe RNA representing the post-
ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is

GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA
ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT
CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT
CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC
TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG
GACCCAC

See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH307HP was a gift from David Bartel (Addgene plasmid # 27385 ; http://n2t.net/addgene:27385 ; RRID:Addgene_27385)
  • For your References section:

    Crystal structure of the catalytic core of an RNA-polymerase ribozyme. Shechner DM, Grant RA, Bagby SC, Koldobskaya Y, Piccirilli JA, Bartel DP. Science. 2009 Nov 27. 326(5957):1271-5. 10.1126/science.1174676 PubMed 19965478