-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLeGO
- Backbone size w/o insert (bp) 8159
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsAny (like TOP10, XL10-Gold or Stbl)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6 promoter, SFFV promoter, IRES-Venus
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GAGCTCACAACCCCTCACTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Venus cDNA is from the Miyawaki lab (http://cfds.brain.riken.jp). The lenti backbone is a derivative of pLentiLox3.7 developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HIV-1 derived third generation lentiviral vector for the expression of a cDNA and an shRNA. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Multiple cloning site for the cDNA: BamHI, EcoRI, SbfI, StuI, NotI. An internal ribosome entry site (IRES) is used to express the marker gene. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LeGO-iV was a gift from Boris Fehse (Addgene plasmid # 27360 ; http://n2t.net/addgene:27360 ; RRID:Addgene_27360) -
For your References section:
A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis. Weber K, Bartsch U, Stocking C, Fehse B. Mol Ther. 2008 Apr . 16(4):698-706. 10.1038/mt.2008.6 PubMed 18362927