LeGO-R
(Plasmid #27355)

• Depositing Lab: Boris Fehse
• Publication: Weber et al Mol Ther. 2008 Apr . 16(4):698-706.

Backbone

• Vector backbone: LeGO
• Backbone size w/o insert (bp): 6747
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Any (like TOP10, XL10-Gold or Stbl)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: U6 promoter, SFFV promoter, dsRed2
• Insert Size (bp): 678

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GAGCTCACAACCCCTCACTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The dsRed2 cDNA is from Clontech. The lenti backbone is a derivative of pLentiLox3.7 developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HIV-1 derived third generation lentiviral vector for shRNAs. Compatibel to shRNAs cloned in pSUPER (XbaI/XhoI). Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de