pAMPK alpha1 full length
(Plasmid #27297)

• Depositing Lab: Morris Birnbaum
• Publication: Birnbaum lab plasmids (unpublished)

Backbone

• Vector backbone: pcDNA3.1/Hygro
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 7300
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AMPK alpha1
• Alt name: AMP activated protein kinase
• Alt name: Prkaa1
• Species: M. musculus (mouse)
• Insert Size (bp): 1700
• Entrez Gene: Prkaa1 (a.k.a. AMPKalpha1, C130083N04Rik)
• Tag / Fusion Protein:
  • his (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • 1153-1156 AMPK
• A portion of this plasmid was derived from a plasmid made by: Peter Leland Dept. of Biochemistry Univ of Wisconsin, Madison 433 Babcock Dr. Madison, WI 53704
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry