pCLX-UBI-VenusN
(Plasmid
#27247)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCLX
- Backbone size w/o insert (bp) 7886
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsTop10 or HB101
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenusNLS
-
SpeciesVenus
-
Insert Size (bp)741
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attR4 (destroyed during cloning)
- 3′ cloning site attR2 (destroyed during cloning)
- 5′ sequencing primer ttctgcaggtcgactctaga (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUli Schiebler
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCLX-UBI-VenusN was a gift from Patrick Salmon (Addgene plasmid # 27247 ; http://n2t.net/addgene:27247 ; RRID:Addgene_27247)