zgc:153086_R (OZ512)
(Plasmid #27187)

• Depositing Lab: Keith Joung
• Publication: Maeder et al Mol Cell. 2008 Jul 25. 31(2):294-301.

Backbone

• Vector backbone: MG414
• Backbone size w/o insert (bp): 5493
• Vector type: Zebrafish Targeting

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Growth instructions: Requires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Zinc finger array targeting zgc:153086
• Alt name: OZ512
• Species: D. rerio (zebrafish)
• Insert Size (bp): 270
• GenBank ID: ENSDARG00000061690

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: OK.61 GGGTAGTACGATGACGGAACCTGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene zgc:153086 (see below). Please note that this plasmid does NOT contain the zgc:153086 sequence.

Users must order the complementary plasmid zgc:153086_L (OZ511) [Addgene plasmid 27186] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.

Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203).

This zinc finger array was tested for binding activity to the sequence 5'-GGAGGTGAG-3' in a bacterial two hybrid assay, and resulted in 10.23 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).

Scientists using this zinc finger array in a publication should notify and acknowledge NIH grant number R01 GM088040 in the publication.

Other Articles:
"Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082

"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934