-
PurposeLentiviral shRNA vector for knockdown of both mouse MKL1 and MKL2.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1-puro
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA MKL1+2
-
gRNA/shRNA sequenceCATGGAGCTGGTGGAGAAGAA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)21
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer hU6-Fwd (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-MKL1/2 shRNA was a gift from Ron Prywes (Addgene plasmid # 27161 ; http://n2t.net/addgene:27161 ; RRID:Addgene_27161) -
For your References section:
Activation and repression of cellular immediate early genes by serum response factor cofactors. Lee SM, Vasishtha M, Prywes R. J Biol Chem. 2010 Jul 16. 285(29):22036-49. 10.1074/jbc.M110.108878 PubMed 20466732