pHR-mCherry-tSH2(ZAP70)
(Plasmid #27137)

• Depositing Lab: Ron Vale
• Publication: Yudushkin et al Proc Natl Acad Sci U S A. 2010 Dec 21;107(51):22128-33.

Backbone

• Vector backbone: pHR'
• Backbone size w/o insert (bp): 9000
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry and ZAP70 (residues 1-259)
• Species: H. sapiens (human)
• Insert Size (bp): 1572
• Entrez Gene: ZAP70 (a.k.a. ADMIO2, IMD48, SRK, STCD, STD, TZK, ZAP-70)
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GCTTCCCGAGCTCTATAAAAGAGC
• 3′ sequencing primer: CCAGAGGTTGATTATCGATAAGC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry