pHR-ZIP(FF)
(Plasmid #27135)

• Depositing Lab: Ron Vale
• Publication: Yudushkin et al Proc Natl Acad Sci U S A. 2010 Dec 21;107(51):22128-33.

Backbone

• Vector backbone: pHR'
• Backbone size w/o insert (bp): 9000
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259)
• Alt name: CD3zeta ITAMs phosphorylation reporter
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 2847
• Mutation: Tyrosines in ITAMS 1-3 mutated to phenylalanines (Y72F, Y83F, Y111F, Y123F, Y142F, Y153F in the insert)
• Entrez Gene: ZAP70 (a.k.a. ADMIO2, IMD48, SRK, STCD, STD, TZK, ZAP-70)
• Entrez Gene: Cd247 (a.k.a. 4930549J05Rik, A430104F18Rik, Cd3, Cd3-eta, Cd3-zeta, Cd3h, Cd3z, Cd3zeta, T3z, Tcrk, Tcrz)
• Tags / Fusion Proteins:
  • eGFP
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GCTTCCCGAGCTCTATAAAAGAGC
• 3′ sequencing primer: CCAGAGGTTGATTATCGATAAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry