Skip to main content
Addgene

pEnt L1L3 rtTA-3
(Plasmid #27106)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27106 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEntr2B
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2300
  • Vector type
    Gateway entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    reverse tetracycline transactivator
  • Alt name
    rtTA
  • Insert Size (bp)
    1100

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCTACAAACTCTTCCTGTTAGT
  • 3′ sequencing primer AGAGATTTTGAGACACGGGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway L1L3 entry vector containing the rtTA regulator, rtTA2s-M2, an optimized version of the rtTA transactivator (see PubMedID 10859354 for details). Promoters can be inserted using PacI and SbfI. Does not contain insulator sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEnt L1L3 rtTA-3 was a gift from Edward Hsiao (Addgene plasmid # 27106 ; http://n2t.net/addgene:27106 ; RRID:Addgene_27106)

  • For your References section:

    Constitutive Gs activation using a single-construct tetracycline-inducible expression system in embryonic stem cells and mice. Hsiao EC, Nguyen TD, Ng JK, Scott MJ, Chang WC, Zahed H, Conklin BR. Stem Cell Res Ther. 2011 Mar 4. 2(2):11. 10.1186/scrt52 PubMed 21375737
Related items:
Commonly requested with: