pEnt L1L3 tTA-3
(Plasmid #27105)

• Depositing Lab: Edward Hsiao
• Publication: Hsiao et al Stem Cell Res Ther. 2011 Mar 4. 2(2):11.

Backbone

• Vector backbone: pEntr2B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2300
• Vector type: Gateway entry vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tetracycline transactivator
• Alt name: tTA
• Insert Size (bp): 1100

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCTACAAACTCTTCCTGTTAGT
• 3′ sequencing primer: AGAGATTTTGAGACACGGGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Gateway L1L3 entry vector containing the tTA regulator. Promoters can be inserted using PacI and SbfI. Does not contain insulator sequence.

Plasmid was constructed as follows: The pEntr2B entry vector (Invitrogen) was digested with PstI and XhoI to remove the attL2 site.
Oligonucleotides containing SalI-XhoI-Bsu36I-NdeI-PacI-EcoRI-NotI flanking the attL3 sequence on the 5' side
and PstI on the 3' side were ligated in to create an intermediate plasmid carrying attL1 and attL3 sites. A LoxP sequence was introduced at the XhoI site. The tTA and pA sequences were subsequently cloned into the EcoRI/NotI sites by PCR cloning from pUHG15-1 to generate pEntL1L3 tTA-3.