pAAV-GFAP-hChR2(H134R)-mCherry
(Plasmid #27055)

• Purpose: AAV expression of humanized ChR2(H134R) fused to mCherry, for optogenetic excitation
• Depositing Lab: Karl Deisseroth
• Publication: hChR2 plasmids (unpublished)

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 6290
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hChR2(H134R)
• Alt name: ChR2
• Species: H. sapiens (human)
• Insert Size (bp): 1647
• Mutation: H134R
• Promoter: GFAP
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI, SalI (not destroyed)
• 3′ cloning site: EcoRI, HinDIII (not destroyed)
• 5′ sequencing primer: ccaaccccaccccctcaggctatg
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains the human GFAP promoter.

For additional information please visit - http://www.optogenetics.org