Psicheck2 COLIA1 full length 3'UTR
(Plasmid #26993)

• Depositing Lab: Joan Massague
• Publication: Tavazoie et al Nature. 2008 Jan 10. 451(7175):147-52.

Backbone

• Vector backbone: psiCHECK-2
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 6300
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: COL1A1 Full length 3' UTR
• Alt name: COL1A1
• Species: H. sapiens (human)
• Insert Size (bp): 1400
• Entrez Gene: COL1A1 (a.k.a. CAFYD, EDSARTH1, EDSC, OI1, OI2, OI3, OI4)
• Tag / Fusion Protein:
  • Renilla Luciferase (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: Rluc-F
• 3′ sequencing primer: psiCHECK2-R (CGAGGTCCGAAGACTCATTT)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A single base pair mutation is present in the UTR insert
that does not alter the miR-335 complementary motif.