-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneClontech N1
- Backbone size w/o insert (bp) 3927
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameREACh-CaMKIIa-mEGFP
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2913
-
Tags
/ Fusion Proteins
- REACh (N terminal on insert)
- mEGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site NotI, XbaI, MfeI, etc (destroyed during cloning)
- 5′ sequencing primer AAATGGGCGGTAGGCGTGTA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Green-Camuialpha was a gift from Ryohei Yasuda (Addgene plasmid # 26933 ; http://n2t.net/addgene:26933 ; RRID:Addgene_26933) -
For your References section:
Activation of CaMKII in single dendritic spines during long-term potentiation. Lee SJ, Escobedo-Lozoya Y, Szatmari EM, Yasuda R. Nature. 2009 Mar 19. 458(7236):299-304. 10.1038/nature07842 PubMed 19295602