pCBFRE-(mt)-luc
(Plasmid #26896)

• Depositing Lab: Nicholas Gaiano
• Publication: Yu et al Cell Stem Cell. 2008 May 8. 2(5):461-71.

Backbone

• Vector backbone: Unknown
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CBFRE
• Alt name: CBF1-responsive element
• Insert Size (bp): 144
• Mutation: Mutated CBF1 sites (see note)
• Tag / Fusion Protein:
  • Luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: n/a
• 3′ sequencing primer: Luc_N_Rev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CBFRE: four (mutated) CBF1-binding elements from EBV (see Hsieh MCB 1996, 16:952) and the basal simian virus 40 (SV40) promoter upstream of Luciferase. The sequence of the mutated CBF1 binding element is (GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG).