pEnt L1L3 EF1a-tTA-2
(Plasmid #26803)

• Depositing Lab: Edward Hsiao
• Publication: Hsiao et al Stem Cell Res Ther. 2011 Mar 4. 2(2):11.

Backbone

• Vector backbone: pEntr2B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4200
• Vector type: Mammalian Expression ; Gateway Entry vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Elongation Factor 1 alpha promoter and tTA transgene
• Alt name: TetOff
• Insert Size (bp): 1700

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCTACAAACTCTTCCTGTTAGT
• 3′ sequencing primer: AGAGATTTTGAGACACGGGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains Gateway L1L3 sites and EF1α promoter driving tTA. Contains insulator sequence.

Plasmid was constructed as follows: The pEntr2B entry vector was digested with PstI and XhoI to remove the attL2 site. Oligonucleotides containing SalI-XhoI-Bsu36I-NdeI-PacI-EcoRI-NotI flanking the attL3 sequence on the 5' side and PstI on the 3' side were ligated in to create an intermediate plasmid carrying attL1 and attL3 sites (from pDest R4-R3. A LoxP sequence was introduced at the XhoI site, and the 500-bp chicken β-globin (CBG) HS4 insulator sequence was introduced at the Bsu36I/NdeI sites. The tTA and pA sequences were subsequently cloned into the EcoRI/NotI sites by PCR cloning from pUHG15-1. The EF1α promoter from pORF9 was cloned into the PacI to generate the final entry vector pEntL1L3 EF1α-tTA-2.