pLenti-hSyn-eNpHR 3.0-EYFP
(Plasmid #26775)

• Purpose: 3rd gen lentiviral expression of eNpHR 3.0 fused to EYFP driven by human Synapsin I promoter for optogenetic inhibition
• Depositing Lab: Karl Deisseroth
• Publication: Gradinaru et al Cell. 2010 Apr 2. 141(1):154-65.

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 8433
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl3 (rec A-) cells to avoid recombinations with the LTRs
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eNpHR 3.0
• Species: H. sapiens (human)
• Insert Size (bp): 1683
• Mutation: Trafficking Signal (TS) ER Export Signal
• Promoter: hSyn
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: ccacgcgaggcgcgagatag
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains the human synapsin I promoter.

For additional information please visit - http://www.optogenetics.org