pLKO.1-puro-cfRab8a_2
(Plasmid
#26707)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1-puro
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedog Rab8a RNAi
-
gRNA/shRNA sequenceGGGCCCTCCCCCTCCAATACT
-
SpeciesC. familiaris (dog RNAi)
-
MutationDog Rab8a RNAi.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dog Rab8a RNAi. RNAi target sequence located within the 3'-UTR of canine Rab8a, so only matches dog. RNAi target sequence is: GGGCCCTCCCCCTCCAATACT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro-cfRab8a_2 was a gift from Keith Mostov (Addgene plasmid # 26707 ; http://n2t.net/addgene:26707 ; RRID:Addgene_26707) -
For your References section:
A molecular network for de novo generation of the apical surface and lumen. Bryant DM, Datta A, Rodriguez-Fraticelli AE, Peranen J, Martin-Belmonte F, Mostov KE. Nat Cell Biol. 2010 Oct 3. ():. 10.1038/ncb2106 PubMed 20890297