-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAV1K
- Backbone size w/o insert (bp) 2792
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAny strain that has LacI repressor; High level of GFP expressed from the vector kills E. coli when in stationary phase.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT5lacOlacOeGFP biobrick
-
SpeciesSynthetic construct
-
Insert Size (bp)861
-
GenBank IDHQ191434
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI, XbaI (not destroyed)
- 3′ cloning site SpeI, PstI (not destroyed)
- 5′ sequencing primer GACGAACTCCAATTCACTGTTCCTTGC
- 3′ sequencing primer GGAGAGCGTTCACCGACAAACAACAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
In our experience, plasmid yields are highest when cells are harvested at late log stage.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAV1K-T5-gfp was a gift from Ichiro Matsumura (Addgene plasmid # 26702 ; http://n2t.net/addgene:26702 ; RRID:Addgene_26702) -
For your References section:
Rational design of a plasmid origin that replicates efficiently in both gram-positive and gram-negative bacteria. Bryksin AV, Matsumura I. PLoS One. 2010 . 5(10):e13244. 10.1371/journal.pone.0013244 PubMed 20949038