-
Purpose3rd gen lentiviral shRNA expression vector containing scrambled shRNA sequence. Uses blasticidin for selection
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1-blast
-
Backbone manufacturerMostov lab (Addgene Plasmid# 26655)
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namescramble
-
gRNA/shRNA sequenceCCTAAGGTTAAGTCGCCCTCG
-
Speciesdoesn't match any mammalian sequence
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-blast-SCRAMBLE was a gift from Keith Mostov (Addgene plasmid # 26701 ; http://n2t.net/addgene:26701 ; RRID:Addgene_26701) -
For your References section:
A molecular network for de novo generation of the apical surface and lumen. Bryant DM, Datta A, Rodriguez-Fraticelli AE, Peranen J, Martin-Belmonte F, Mostov KE. Nat Cell Biol. 2010 Oct 3. ():. 10.1038/ncb2106 PubMed 20890297