FCbAIGW
(Plasmid #26669)

• Purpose: (Empty Backbone)
• Depositing Lab: Gerardo Morfini
• Publication: Gerardo Morfini plasmids (unpublished)

Backbone

• Vector backbone: FCbAIGW
• Backbone size (bp): 11067
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Growth instructions: Stbl2
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: None
• Tag / Fusion Protein:
  • IRES-EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: FUGW-Fwd (ATTACAGGGACAGCAGAGATCC)
• 3′ sequencing primer: EGFP-N

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The vector has neuron specific promoter with downstream IRES2-EGFP sequence which allow the fluorescence marker protein to be expressed in a lower level under the same promoter with the transgene.