pGEM-3z/601
(Plasmid #26656)

• Depositing Lab: Jonathan Widom
• Publication: Lowary et al J Mol Biol. 1998 Feb 13. 276(1):19-42.

Backbone

• Vector backbone: pGEM-3Z
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 2743
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None
• Insert Size (bp): 282

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HincII (unknown if destroyed)
• 3′ cloning site: HincII (unknown if destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: SP6

Resource Information

• Articles Citing this Plasmid:
  • 17 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"601".

Primers that are used by the Widom lab to amplify the 147 bp fragment:

Forward:
ctggagaatcccggtgccg

Reverse:
acaggatgtatatatctgacacg

Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.