Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1 Sox2 3H b
(Plasmid #26352)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26352 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sox2 shRNA
  • Species
    H. sapiens (human)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SOX2b shRNA sequence - CTGCCGAGAATCCATGTATAT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 Sox2 3H b was a gift from Matthew Meyerson (Addgene plasmid # 26352 ; http://n2t.net/addgene:26352 ; RRID:Addgene_26352)
  • For your References section:

    SOX2 is an amplified lineage-survival oncogene in lung and esophageal squamous cell carcinomas. Bass AJ, Watanabe H, Mermel CH, Yu S, Perner S, Verhaak RG, Kim SY, Wardwell L, Tamayo P, Gat-Viks I, Ramos AH, Woo MS, Weir BA, Getz G, Beroukhim R, O'Kelly M, Dutt A, Rozenblatt-Rosen O, Dziunycz P, Komisarof J, Chirieac LR, Lafargue CJ, Scheble V, Wilbertz T, Ma C, Rao S, Nakagawa H, Stairs DB, Lin L, Giordano TJ, Wagner P, Minna JD, Gazdar AF, Zhu CQ, Brose MS, Cecconello I, Jr UR, Marie SK, Dahl O, Shivdasani RA, Tsao MS, Rubin MA, Wong KK, Regev A, Hahn WC, Beer DG, Rustgi AK, Meyerson M. Nat Genet. 2009 Nov . 41(11):1238-42. 10.1038/ng.465 PubMed 19801978