pBS130
(Plasmid #26290)

• Depositing Lab: Tom Clandinin
• Publication: Gohl et al Nat Methods. 2011 Mar;8(3):231-7. doi: 10.1038/nmeth.1561.

Backbone

• Vector backbone: pUC HSP-Delta23
• Backbone size w/o insert (bp): 6427
• Vector type: Bacterial Expression, Insect Expression ; Drosophila transgenesis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: phiC31 integrase
• Species: Streptomyces phage phiC31
• Insert Size (bp): 1839
• Entrez Gene: int (a.k.a. phiC31p51)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: gcttcgtctacggagcgaca

Resource Information

• Articles Citing this Plasmid:
  • 10 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There is one nucleotide deletion in the promoter region of Addgene sequence that does not alter function.