pGL2-hOct4 DE-SV40-Luc
(Plasmid #26279)

• Purpose: Addgene next-generation sequencing identified numerous modifications from the indicated plasmid backbone. Please see the sequences link for additional information.
• Depositing Lab: Rudolf Jaenisch
• Publication: Hanna et al Proc Natl Acad Sci U S A. 2010 May 18. 107(20):9222-7.

Backbone

• Vector backbone: pGL2-SV40-Luc
• Backbone size w/o insert (bp): 5000
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Oct4 Distal Enhancer Element (DE)
• Species: H. sapiens (human)
• Insert Size (bp): 2002
• Mutation: See Depositor Comments below
• Entrez Gene: POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ggtacccattgagtccaaatcct

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Backbone kindly provided from Dr. Ron Mckay and Dr. Paul Tesar

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS identified multiple sequence variants in the insert sequence, relative to the depositor provided sequence. See the sequences page for additional details.