pXN-FBLWLF-GAL4AD
(Plasmid #26263)

• Depositing Lab: Tom Clandinin
• Publication: Gohl et al Nat Methods. 2011 Mar;8(3):231-7. doi: 10.1038/nmeth.1561.

Backbone

• Vector backbone: pXN-FBLWLF
• Backbone size w/o insert (bp): 8757
• Vector type: Bacterial Expression, Insect Expression ; Drosophila transgenesis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Gal4AD-Zip+
• Alt name: GAL4AD-EE12RR345L
• Alt name: GAL4
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 670
• Entrez Gene: GAL4 (a.k.a. YPL248C, GAL81)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: CAGTGCACGTTTGCTTGTTGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pActPL-Gal4AD (obtained from Addgene)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Luan et al. Neuron. 2006 Nov 9. 52(3):425-36.