Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBPHLWL-GAL80
(Plasmid #26257)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26257 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBPHLWL
  • Backbone size w/o insert (bp) 7963
  • Vector type
    Bacterial Expression, Insect Expression ; Drosophila transgenesis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GAL80
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1325
  • Entrez Gene
    GAL80 (a.k.a. YML051W)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CAGTGCACGTTTGCTTGTTGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    From pCASPTubGAL80 (from Lee and Luo. 1999. Neuron. 22, 451-461)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBPHLWL-GAL80 was a gift from Tom Clandinin (Addgene plasmid # 26257 ; http://n2t.net/addgene:26257 ; RRID:Addgene_26257)
  • For your References section:

    A versatile in vivo system for directed dissection of gene expression patterns. Gohl DM, Silies MA, Gao XJ, Bhalerao S, Luongo FJ, Lin CC, Potter CJ, Clandinin TR. Nat Methods. 2011 Mar;8(3):231-7. doi: 10.1038/nmeth.1561. 10.1038/nmeth.1561 PubMed 21473015