pmRFPmars
(Plasmid #26252)

• Depositing Lab: Martin Fraunholz
• Publication: Paprotka et al J Microbiol Methods. 2010 Aug 10. ():.

Backbone

• Vector backbone: pCerulean
• Backbone manufacturer: Martin Fraunholz
• Backbone size w/o insert (bp): 6500
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mRFPmars
• Species: synthetic
• Insert Size (bp): 702
• Mutation: KpnI restriction site removed
• GenBank ID: AY679163
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ctaatgcgctgttaatcactttac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: mRFPmars received from Annette Müller-Taubenberger (Munich, Germany). Fischer, M., Haase, I., Simmeth, E., Gerisch, G. and Müller-Taubenberger, A. (2004). A brilliant monomeric red fluorescent protein to visualize cytoskeleton dynamics in Dictyostelium. FEBS Lett 577, 227-232.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Antibiotic selection: Ampicillin in E. coli, Chloramphenicol in S. aureus