pBPGAL80Uw-6
(Plasmid #26236)

• Depositing Lab: Gerald Rubin
• Publication: Pfeiffer et al Genetics. 2010 Aug 9. ():.

Backbone

• Vector backbone: pBPGUw
• Backbone size w/o insert (bp): 9409
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Growth instructions: ccdB Survival 2T1 strain (Invitrogen), or equivalent, must be used to propagate plasmids carrying the ccdB gene.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GAL80
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1308
• Entrez Gene: GAL80 (a.k.a. YML051W)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: DSCP F: GAGCTCGCCCGGGGATC
• 3′ sequencing primer: GAL80 R: GACTCCGCCTGATCGAGCGAGC

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry