pJFRC4-3XUAS-IVS-mCD8::GFP
(Plasmid #26217)

• Depositing Lab: Gerald Rubin
• Publication: Pfeiffer et al Genetics. 2010 Aug 9. ():.

Backbone

• Vector backbone: pJFRC-MUH
• Backbone size w/o insert (bp): 7768
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCD8::GFP
• Species: M. musculus (mouse)
• Insert Size (bp): 1389

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: hsp70 F: GAGCGCCGGAGTATAAATAGAG
• 3′ sequencing primer: SV40 R: CCATTCATCAGTTCCATAGG

Resource Information

• Supplemental Documents:
  • Author's PDF Map of pJFRC4-3XUAS-IVS-mCD8::GFP
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry