pMV306hsp+Lux
(Plasmid #26159)

• Depositing Labs: Brian Robertson, Siouxsie Wiles
• Publication: Andreu et al PLoS One. 2010 May 24;5(5):e10777.

Backbone

• Vector backbone: pMV306hsp
• Backbone size w/o insert (bp): 4373
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Bacterial luciferase operon
• Alt name: LuxABCDE
• Species: Photorhabdus luminescens
• Insert Size (bp): 5722
• Mutation: It contains a gram-positive enhanced translation signal in front of luxA, luxC and luxE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRV (destroyed during cloning)
• 5′ sequencing primer: agaataacgttggcactcgc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Genes were cloned from vector pSB2025 obtained from Dr. Phil Hill at Nottingham University.
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The sequence of the Lux operon is theoretical. As such, there are a few differences between Addgene sequence and full plasmid sequence. These differences do not affect plasmid function.

Qazi, S.N., et al., agr expression precedes escape of internalized Staphylococcus aureus from the host endosome. Infect Immun, 2001. 69(11): p. 7074-82.